lc model 6.1 software Search Results


96
ATCC cell lines hepa1c1c7 atcc crl 2026 hepg2 atcc hb
Cell Lines Hepa1c1c7 Atcc Crl 2026 Hepg2 Atcc Hb, supplied by ATCC, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/lc+model+6%2E1+software/10__1016_slash_j__isci__2026__114680-311-141-144?v=ATCC
Average 96 stars, based on 1 article reviews
cell lines hepa1c1c7 atcc crl 2026 hepg2 atcc hb - by Bioz Stars, 2026-06
96/100 stars
  Buy from Supplier

90
Micromass UK Limited low resolution liquid chromatography/mass spectrometry, electrospray ionization mode
Low Resolution Liquid Chromatography/Mass Spectrometry, Electrospray Ionization Mode, supplied by Micromass UK Limited, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/lc+model+6%2E1+software/us08278342-592-17-21?v=Micromass+UK+Limited
Average 90 stars, based on 1 article reviews
low resolution liquid chromatography/mass spectrometry, electrospray ionization mode - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
SAS institute 9.4 analytical software
9.4 Analytical Software, supplied by SAS institute, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/lc+model+6%2E1+software/pm39609749-194-5-5?v=SAS+institute
Average 90 stars, based on 1 article reviews
9.4 analytical software - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

99
Shimadzu Corporation lab solutions lc ms software 9050
Lab Solutions Lc Ms Software 9050, supplied by Shimadzu Corporation, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/lc+model+6%2E1+software/10__3390_slash_agronomy14020317-84-12-11?v=Shimadzu+Corporation
Average 99 stars, based on 1 article reviews
lab solutions lc ms software 9050 - by Bioz Stars, 2026-06
99/100 stars
  Buy from Supplier

99
Shimadzu Corporation shimadzu nexera instrument
Shimadzu Nexera Instrument, supplied by Shimadzu Corporation, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/lc+model+6%2E1+software/pm39675684-75-25-25?v=Shimadzu+Corporation
Average 99 stars, based on 1 article reviews
shimadzu nexera instrument - by Bioz Stars, 2026-06
99/100 stars
  Buy from Supplier

90
ChromSword hplc modeling software acd/lc simulator
Hplc Modeling Software Acd/Lc Simulator, supplied by ChromSword, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/lc+model+6%2E1+software/pmc09543774-8-6-11?v=ChromSword
Average 90 stars, based on 1 article reviews
hplc modeling software acd/lc simulator - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
MedCalc Software Ltd (version 16.4 for window, ostend, belgium) program
(Version 16.4 For Window, Ostend, Belgium) Program, supplied by MedCalc Software Ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/lc+model+6%2E1+software/10__3348_slash_jksr__2018__79__4__181-68-16-9?v=MedCalc+Software+Ltd
Average 90 stars, based on 1 article reviews
(version 16.4 for window, ostend, belgium) program - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
Cyberlab Inc hplc lc 100
Hplc Lc 100, supplied by Cyberlab Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/lc+model+6%2E1+software/10__7324_slash_japs__2025__206829-146-13-16?v=Cyberlab+Inc
Average 90 stars, based on 1 article reviews
hplc lc 100 - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
COMSOL Inc multiphysics software package 61
Multiphysics Software Package 61, supplied by COMSOL Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/lc+model+6%2E1+software/pmc04067612__srep05424___s1-24-8-12?v=COMSOL+Inc
Average 90 stars, based on 1 article reviews
multiphysics software package 61 - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

99
ATCC cell lines hamster cho k1 cells atcc ccl 61 human
Cell Lines Hamster Cho K1 Cells Atcc Ccl 61 Human, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/lc+model+6%2E1+software/pm37552987-231-73-78?v=ATCC
Average 99 stars, based on 1 article reviews
cell lines hamster cho k1 cells atcc ccl 61 human - by Bioz Stars, 2026-06
99/100 stars
  Buy from Supplier

90
ChromSword software modeling packages
Software Modeling Packages, supplied by ChromSword, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/lc+model+6%2E1+software/pm23454599-50-15-19?v=ChromSword
Average 90 stars, based on 1 article reviews
software modeling packages - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

99
ATCC cell lines cho k1 atcc ccl 61 rrid cvcl 0214 c2c12 atcc crl 1772
KEY RESOURCES TABLE
Cell Lines Cho K1 Atcc Ccl 61 Rrid Cvcl 0214 C2c12 Atcc Crl 1772, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/lc+model+6%2E1+software/pmc11191318-786-15-18?v=ATCC
Average 99 stars, based on 1 article reviews
cell lines cho k1 atcc ccl 61 rrid cvcl 0214 c2c12 atcc crl 1772 - by Bioz Stars, 2026-06
99/100 stars
  Buy from Supplier

Image Search Results


KEY RESOURCES TABLE

Journal: Cell chemical biology

Article Title: Insulin sensitization by small molecules enhancing GLUT4 translocation

doi: 10.1016/j.chembiol.2023.06.012

Figure Lengend Snippet: KEY RESOURCES TABLE

Article Snippet: ProteomeXchange PXD034052 Structure of Unc119-inhibitor complex PDB dataset ID: D_1000264081 PDB ID: 7UMO Experimental models: Cell lines CHO-K1 ATCC CCL-61, RRID: CVCL_0214 C2C12 ATCC CRL-1772; RRID: CVCL_0188 HBG4 This paper N/A Experimental models: Organisms/strains C57BL/6 Jackson Laboratory RRID:IMSR_JAX: 000664 HBG4 This paper N/A Oligonucleotides gRNA targeting GLUT4: CTGGGTAGGCAAGGTCCTGG This paper N/A SLC2A4 forw: ACA GCT CTC AGG CAT CAA TG This paper N/A SLC2A4 rev: GTT CTA CTA AGA GCA CCG AGA This paper N/A TBC1D4 forw: CAT CTG TTA TGT GTT CCA GTG C This paper N/A TBC1D4 rev: CAG TTT AAT CTG CGT CTT GGC This paper N/A TBC1D1 forw: CTT ATT GAG TCC TCG CCT CTC This paper N/A TBC1D1 rev: GCT TTG GAT CCT AGC ATT TGC This paper N/A Actin forw: GAC TCA TCG TAC TCC TGC TTG This paper N/A Actin rev: GAT TAC TGC TCT GGC TCC TAG This paper N/A gRNA_1-Unc119: ACCAAGGCGGGACGGCA CCUGUUUUAGAGCUAUGCU This paper N/A gRNA-Unc119_2: GGAUCACGGGUGGUG AGCACGUUUUAGAGCUAUGCU This paper N/A Unc119 forw: GGTCAGGGAACAAGCAAGAA This paper N/A Unc119 rev: GGAGGCAAAGAGAGAGAGAGTA This paper N/A gRNA-Unc119b_1: AGCACGUCCUACGCCUC AACGUUUUAGAGCUAUGCU This paper N/A gRNA-Unc119b_2: ACCAAGAUGGCCGCCA CCUCGUUUUAGAGCUAUGCU This paper N/A Unc119b forw: GGGAACTTTCAGGATAGCATTTG This paper N/A Unc119b rev: GTTGGTCAGATCAGCAGGAT This paper N/A Recombinant DNA secLgBiT Adenovirus plasmid This paper N/A HiBiT-GLUT4-mCherry Lentivirus plasmid This paper N/A PPRE-X3-TK-Luc Addgene Plasmid #1015 Software and algorithms Prism 9 GraphPad N/A Persus Persus N/A X-ray detector XDS N/A Scala CCP4 program suite N/A PMOD software version 3.709 PMOD Technologies N/A Open in a separate window KEY RESOURCES TABLE.

Techniques: Virus, Recombinant, In Vivo, Plasmid Preparation, Software