Journal: Cell

Article Title: Structures of the human HCN1 hyperpolarization-activated channel

doi: 10.1016/j.cell.2016.12.023

Figure Lengend Snippet: KEY RESOURCES TABLE

Article Snippet: ​ REAGENT or RESOURCE SOURCE IDENTIFIER Chemicals, Peptides, and Recombinant Proteins DMEM/F-12 medium Gibco 11330-032 Sf-900 II SFM medium Gibco 10902-088 Freestyle 293 medium Gibco 12338-018 Lipofectamine 3000 reagent Invitrogen L3000015 Cellfectin II reagent Invitrogen 10362100 lauryl maltose neopentyl glycol Anatrace NG310 Cholesteryl hemisuccinate Anatrace CH210 Digitonin Calbiochem 300410 3′,5′-cyclic AMP sodium salt Sigma-Aldrich A6885 Critical Commercial Assays CNBR-activated Sepharose beads GE Healthcare 17-0430-01 Superose 6, 10/300 GL GE Healthcare 17-5172-01 Deposited Data Human HCN1 EM density map This study EMDB: EMD-8511 Human HCN1 EM with cAMP density map This study EMDB: EMD-8512 Human HCN1 EM atomic model This study PDB: 5U6O Human HCN1 EM with cAMP atomic model This study PDB: 5U6P Experimental Models: Cell Lines CHO-K1 ATCC CRL-9618 Sf9 ATCC CRL-1711 HEK293S GnTI - ATCC CRL-3022 Recombinant DNA Human HCN1 EM This study N/A Software and Algorithms Seriel EM Mastronarde, 2005 http://bio3d.colorado.edu/SerialEM Unblur Grant and Grigorieff, 2015b http://grigoriefflab.janelia.org/unblur Gctf Zhang, 2016 http://www.mrc-lmb.cam.ac.uk/kzhang/ RELION Scheres, 2012 http://www2.mrc-lmb.cam.ac.uk/relion Gautomatch Kai Zhang http://www.mrc-lmb.cam.ac.uk/kzhang/ EMAN2 Tang et al., 2007 http://blake.bcm.edu/emanwiki/EMAN2 Blocres Cardone et al., 2013 https://lsbr.niams.nih.gov/bsoft/programs/blocres.html ResMap Kucukelbir et al., 2014 http://resmap.sourceforge.net/ SWISS-MODEL Biasini et al., 2014 https://swissmodel.expasy.org/ UCSF Chimera Pettersen et al., 2004 https://www.cgl.ucsf.edu/chimera PHENIX Afonine et al., 2013 https://www.phenix-online.org COOT Emsley et al., 2010 https://www2.mrc-lmb.cam.ac.uk/personal/pemsley/coot REFMAC Brown et al., 2015 ; Murshudov et al., 2011 https://www2.mrc-lmb.cam.ac.uk/groups/murshudov/content/em_fitting/em_fitting.html ProSMART Nicholls et al., 2014 https://www2.mrc-lmb.cam.ac.uk/groups/murshudov/content/prosmart/prosmart.html MolProbity Chen et al., 2010 http://molprobity.biochem.duke.edu EMRinger Barad et al., 2015 http://fraserlab.com/2015/02/18/EMringer/ HOLE Smart et al., 1996 http://www.smartsci.uk/hole PyMOL Schrodinger LLC, 2015 http://www.pymol.org Other R1.2/1.3 400 mesh Au holey carbon grids Quantifoil 1210627 Open in a separate window KEY RESOURCES TABLE Structures of the human HCN1 hyperpolarization-activated channel at 3.5 Å resolution Channel filter adopts a particular conformation, allowing both K + and Na + to permeate Long S4 helix and unusual coupling to the pore mediate reversed polarity gating Cyclic AMP induces a rotation of cytoplasmic domains to favor channel opening

Techniques: Recombinant, Software

Journal: Cell chemical biology

Article Title: Insulin sensitization by small molecules enhancing GLUT4 translocation

doi: 10.1016/j.chembiol.2023.06.012

Figure Lengend Snippet: KEY RESOURCES TABLE

Article Snippet: ProteomeXchange PXD034052 Structure of Unc119-inhibitor complex PDB dataset ID: D_1000264081 PDB ID: 7UMO Experimental models: Cell lines CHO-K1 ATCC CCL-61, RRID: CVCL_0214 C2C12 ATCC CRL-1772; RRID: CVCL_0188 HBG4 This paper N/A Experimental models: Organisms/strains C57BL/6 Jackson Laboratory RRID:IMSR_JAX: 000664 HBG4 This paper N/A Oligonucleotides gRNA targeting GLUT4: CTGGGTAGGCAAGGTCCTGG This paper N/A SLC2A4 forw: ACA GCT CTC AGG CAT CAA TG This paper N/A SLC2A4 rev: GTT CTA CTA AGA GCA CCG AGA This paper N/A TBC1D4 forw: CAT CTG TTA TGT GTT CCA GTG C This paper N/A TBC1D4 rev: CAG TTT AAT CTG CGT CTT GGC This paper N/A TBC1D1 forw: CTT ATT GAG TCC TCG CCT CTC This paper N/A TBC1D1 rev: GCT TTG GAT CCT AGC ATT TGC This paper N/A Actin forw: GAC TCA TCG TAC TCC TGC TTG This paper N/A Actin rev: GAT TAC TGC TCT GGC TCC TAG This paper N/A gRNA_1-Unc119: ACCAAGGCGGGACGGCA CCUGUUUUAGAGCUAUGCU This paper N/A gRNA-Unc119_2: GGAUCACGGGUGGUG AGCACGUUUUAGAGCUAUGCU This paper N/A Unc119 forw: GGTCAGGGAACAAGCAAGAA This paper N/A Unc119 rev: GGAGGCAAAGAGAGAGAGAGTA This paper N/A gRNA-Unc119b_1: AGCACGUCCUACGCCUC AACGUUUUAGAGCUAUGCU This paper N/A gRNA-Unc119b_2: ACCAAGAUGGCCGCCA CCUCGUUUUAGAGCUAUGCU This paper N/A Unc119b forw: GGGAACTTTCAGGATAGCATTTG This paper N/A Unc119b rev: GTTGGTCAGATCAGCAGGAT This paper N/A Recombinant DNA secLgBiT Adenovirus plasmid This paper N/A HiBiT-GLUT4-mCherry Lentivirus plasmid This paper N/A PPRE-X3-TK-Luc Addgene Plasmid #1015 Software and algorithms Prism 9 GraphPad N/A Persus Persus N/A X-ray detector XDS N/A Scala CCP4 program suite N/A PMOD software version 3.709 PMOD Technologies N/A Open in a separate window KEY RESOURCES TABLE.

Techniques: Virus, Recombinant, In Vivo, Plasmid Preparation, Software